Knockdown of the bovine prion gene PRNP using RNA interference
Author Information
Author(s): Sutou Shizuyo, Kunishi Miho, Kudo Toshiyuki, Wongsrikeao Pimprapar, Miyagishi Makoto, Otoi Takeshige
Primary Institution: School of Pharmacy, Shujitsu University
Hypothesis
Bovine animals with reduced prion protein (PrP) would be tolerant to BSE.
Conclusion
The most effective siRNA for knocking down bPRNP was found to be 21 mer GGGGAGAACTTCACCGAAACT, providing a basis for further studies in vivo.
Supporting Evidence
- Four siRNA expression plasmid vectors were tested for their ability to knock down bPRNP.
- Six target sites of bPRNP were designed and evaluated for effectiveness.
- Longer siRNAs were generally less effective than shorter ones.
Takeaway
Scientists are trying to make cows that can't get mad cow disease by reducing a specific protein in their bodies using a special technique called RNA interference.
Methodology
The study involved creating siRNA expression plasmid vectors and testing their effectiveness in cultured mammalian cells.
Limitations
The study was conducted in vitro, and the effectiveness in vivo remains to be confirmed.
Digital Object Identifier (DOI)
Want to read the original?
Access the complete publication on the publisher's website